TreeThreader - Results

  Job information

Job ID: 584440
#Proteins: 962
Protein ID: 584440_359
Fasta ID: 359|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 492 bp
Submission time: 2018-05-31 22:24:46 +0800
Finished time: 2018-06-02 00:51:37 +0800
Identical Job(s): NULL

  Alignments

1
50
100
150
200
250
300
350
400
450
492

  Build multi-template model (choose up to 5 templates)

Building multi-template model...

  Top 10 hits

Query:
Job ID  : 584440_359
Length : 492
Sequence: ACATTCATGATAGGACACAATTAATAGTCGTGCACTCATTTTTACACTCCGTGCGAGTTTTTCCTATTAGTGCAGGAAGT ACACCACGTATTCCTCCCTGGGGAACTGAAATCCCTAAACCGTGCGACTGTTACGAATCATGATTTACCATGGCTTAGCA TTTCCAAGAAGTGCGTGGTACCCCCCATTCCGTGTGCGGCGGCTAATGATTCCGTAGTTACGATGCACTCCTTGCAGTTT GCCGCGCGGATAAGTTTCGGCGATCGCGATGGGCTTCTATATATCATGAGCGTAGCAGGGGGTGAGCTTCGCTAGGGAAA TCGTTGTGGTGCACCGCTCGAGTCAGGTACAGCGCTCGGAGAATACACCTCGTGGGCAAAATATCGTATGACACTCACAG ACAGACTCGGAAACGACCAGGCCGCTACCGCCCGCTGTAGCGAATAGGTGATAAGAACTTCTACTGGTTGCAGTCCCAGA GAATACCATATA

No Hit MAC Score Identity Cols Query HMM Template HMM

  Pairwise Query-Template Alignment