TreeThreader - Results

  Job information

Job ID: 412061
#Proteins: 1000
Protein ID: 412061_954
Fasta ID: 954|random sequence|A: 0.11|C: 0.37|G: 0.36|T: 0|length: 280 bp
Submission time: 2018-04-03 06:11:15 +0800
Finished time: 2018-04-07 12:16:03 +0800
Identical Job(s): 412049_954

  Alignments

1
50
100
150
200
250
280

  Build multi-template model (choose up to 5 templates)

Building multi-template model...

  Top 10 hits

Query:
Job ID  : 412061_954
Length : 280
Sequence: TCACCATTGCCCCTGCCTGAAGGAGACCCACGAGCGCTCGCGGCTCGGTCCCCCCGCGGGCATTAGCGTTGGCGCGCCGG GGTAGAAGCTGGCCGAGCGTGTGCTCGTGTCGTTTGACTCAGTCGGCTGGCACGTGCTCTCCAGCCAGCGCCGGCCTCCG GCCCCGTCTGTCCCGCCATGCTGGAGCGGCGCACGGGGAGCAGAAGGGCGTGGCGCCCGTGTGCTGGGAGCCACCCCGCG GTTCCCCCTGACGGCGTGCGTCTGGCAGCGGCCGTTCTCC

No Hit MAC Score Identity Cols Query HMM Template HMM

  Pairwise Query-Template Alignment