TreeThreader - Results

  Job information

Job ID: 412049
#Proteins: 1000
Protein ID: 412049_958
Fasta ID: 958|random sequence|A: 0.11|C: 0.37|G: 0.36|T: 0|length: 245 bp
Submission time: 2018-04-03 05:32:17 +0800
Finished time: 2018-04-07 02:24:06 +0800
Identical Job(s): 412061_958

  Alignments

1
50
100
150
200
245

  Build multi-template model (choose up to 5 templates)

Building multi-template model...

  Top 10 hits

Query:
Job ID  : 412049_958
Length : 245
Sequence: ATCGGGCCCGGGCGCCGGACCTTTCCTTTGTCACGGTGTTGAAGCCTTCCGTTTGGGGAGGGTGCCCTGGCGGGGGGCGG GCCGACCTGCCACGGTAGACCGCCGACCGCCCGGTGTTTCCTCCGCCTGCTATACTGTGCCCGCCCGGCCACCCGAGCGG CGCTGCTGACGGGTCGCCGGGGCCCCAAAAGAGAGGTCCCCGTCGGGCGAGCCCCTCTGGAACCGCGCCGGATGCCCTTC GCGGT

No Hit MAC Score Identity Cols Query HMM Template HMM

  Pairwise Query-Template Alignment