TreeThreader - Results

  Job information

Job ID: 412049
#Proteins: 1000
Protein ID: 412049_287
Fasta ID: 287|random sequence|A: 0.11|C: 0.37|G: 0.36|T: 0|length: 295 bp
Submission time: 2018-04-03 04:02:42 +0800
Finished time: 2018-04-04 01:27:52 +0800
Identical Job(s): NULL

  Alignments

1
50
100
150
200
250
295

  Build multi-template model (choose up to 5 templates)

Building multi-template model...

  Top 10 hits

Query:
Job ID  : 412049_287
Length : 295
Sequence: GCGACGGCCGCCTCGGGGGGGTACATGTCGGCCGGTGGTCTGTGCGGCGCGGTACTCCTTCGCCTTTCCGGGGCTCGTCC CCCCGCGGGGTACGGGTCCGTGTGCGCACCTAGCGGGACCCTGGAGGCTGACTTTGACCGGGGAGGACCTCGGGTCTCCC GCTCGGCGAGCTGGAGACCCGCCACGGGCGGCCGCGGTCCCGGGGCCCCATGGCCTGATCCATATGATACTGACTCGCGC CCGCCATCGACCTGTCGGCCCACGCAGCGTGCCGGTCCTCTCCGACAGACCGGCA

No Hit MAC Score Identity Cols Query HMM Template HMM

  Pairwise Query-Template Alignment