TreeThreader - Results

  Job information

Job ID: 43238
#Proteins: 877
Protein ID: 43238_669
Fasta ID: 669|random sequence|A: 0.11|C: 0.12|G: 0.13|T: 0.64|length: 500 bp
Submission time: 2017-01-11 06:06:38 +0800
Finished time: 2017-08-16 21:36:07 +0800
Identical Job(s): NULL

  Alignments

1
50
100
150
200
250
300
350
400
450
500
500

  Build multi-template model (choose up to 5 templates)

Building multi-template model...

  Top 10 hits

Query:
Job ID  : 43238_669
Length : 500
Sequence: TTTCCATTTCAATTATTAGATTCCCGATTTGTATTACGAGATTTTATTTCTCTTGGTGTTTTTTTAGTTCATTTGTTTCT TTCTTCTTTCTTCTTCTCTGTTTTCTTTTATTCAGTTTCCCGTTTTGTTTTTGGTTTTTATTTTTTTTTTTTGTTGCGTT TTTTGTCACTGTCTTTTTTTTTCATCATATTGGTTTTCTTTTGTCGTTTTTATATGTACTATCTTACTATTTGTTGTTTT TTATAGCTTTTTTCTTTTAGTATTTGTTTTTGTGTTTTTTTTTTTTTGGTTTTCGGTTTAGTAGATCCTTGACTCTGTTT CCATGTCTTTTTCTTTTTTGCTTTGTTTCTTTTCATTGTATATTGTAAGATTATTTGCTGTGTAGTTTTTTGTTTCCAGT TTAGTTTAGTTTACTTTCCGCTAGTTTTATTTCTTTATTTGCTTGTTTTTGTTTGGATTTGTCTTTATAGTTTTTTTTTC TTTTTTTTCTGTTCTTTTTA

No Hit MAC Score Identity Cols Query HMM Template HMM

  Pairwise Query-Template Alignment