TreeThreader - Results

  Job information

Job ID: 41857
#Proteins: 1000
Protein ID: 41857_999
Fasta ID: 999|random sequence|A: 0.12|C: 0.13|G: 0.3|T: 0.25|length: 300 bp
Submission time: 2016-12-11 05:39:22 +0800
Finished time: 2017-08-14 01:46:43 +0800
Identical Job(s): NULL

  Alignments

1
50
100
150
200
250
300
300

  Build multi-template model (choose up to 5 templates)

Building multi-template model...

  Top 10 hits

Query:
Job ID  : 41857_999
Length : 300
Sequence: AATCTTTTAGAGTGTCACTGTTAGTAGTTATGTGGGCAATGTTTTTGTTTTTTTACGGATTGTGCTGATGTTGGTGGGTC GGGTATTTGTTCGGTTACTGGTGTGGGTTGGGTGTGGGCATTTGTTTTCTTCTGTTGCGTTCGTGATGTGTGTGTGCCTT GTTAATTGGATGGGGTTTGTGACCAGTTTTTGTTGATCTATCTTAATTCGGTTGTGTCTGTCGAGGCCAGAGATGTTGTA TTCCTTCGGCTTTCTCGTAGTCTGTTGTTTTGTTTCGATTGGTGTCCTCTGTCGACATAC

No Hit MAC Score Identity Cols Query HMM Template HMM

  Pairwise Query-Template Alignment