TreeThreader - Results

  Job information

Job ID: 41840
#Proteins: 1000
Protein ID: 41840_688
Fasta ID: 688|random sequence|A: 0.26|C: 0.27|G: 0.28|T: 0.25|length: 426 bp
Submission time: 2016-12-09 06:53:36 +0800
Finished time: 2017-08-12 14:24:36 +0800
Identical Job(s): NULL

  Alignments

1
50
100
150
200
250
300
350
400
426

  Build multi-template model (choose up to 5 templates)

Building multi-template model...

  Top 10 hits

Query:
Job ID  : 41840_688
Length : 426
Sequence: GCAACAGGCCGAGAGGCAAGACCAATGCCACAGGGCTTGCGAAAAGGCGATCACCGGCAAAATGATAGGGTAACTCCCTT ACTGCCTTGCATCCCAGAGGTGCAGGTAACCCGATCCGGGCGATTCCAGGGCCTCGTCTCGAAAACCCAGGTGTACTGCG TACTGGGACCGAAATCGTGACTGATCATTAATACACCTAAGATTCGATGGCGGCATCTAGTACGCTATCATTGGTCAACA AACGGCGTAGGTATATAGAGGCACAAGGACAACAGCTGACGTTTTAAACCCGAGTAGTCTGAGTTCACATCCGAGTGACC CTTGGGGAGCAGCCGCACTGGATGTCCGGTACGCAGACGTTGGGATCTGGTTCACAGCTCTGATCGATCTAACTCGGGCG CTCACTGACGCAACGACCCCCGGGGG

No Hit MAC Score Identity Cols Query HMM Template HMM

  Pairwise Query-Template Alignment