TreeThreader - Results

  Job information

Job ID: 41708
#Proteins: 1000
Protein ID: 41708_391
Fasta ID: 391|random sequence|A: 0.1|C: 0.16|G: 0.28|T: 0.5|length: 400 bp
Submission time: 2016-12-06 05:50:00 +0800
Finished time: 2017-08-11 05:19:11 +0800
Identical Job(s): NULL

  Alignments

1
50
100
150
200
250
300
350
400
400

  Build multi-template model (choose up to 5 templates)

Building multi-template model...

  Top 10 hits

Query:
Job ID  : 41708_391
Length : 400
Sequence: GCCCCTTGGGGTGGAATGCCTTCTCTTAGTTCTAACCCTAACTTGTGGCGTCTTGTACTCCGTCGATGGTTCGGTTCTGT GGGTGCGGTTTTCGTTGTGGTGATTTTTTAGCTTTTTTGTTTTTTTTTCCTGGGGGCCTCACATCTTTTTCTTGGTTGTG TTGACTCGGTTTTGTATTGGATTTCTTGTTACGGTGGGGTTTGGAGTTTTTTCGCCTGTATCGTTTAGTATGTCTATTGT GGCATTGGGTGTCCGCTTTTTGGAACTCGTGTGGGTATTGACCATTCCACGTGATGTTTTTGTCGGGGTTGTTGTATAGC GTTTCTTTCCAGATTCTTCTTTTTGTGGGAGTCTCGTGTTTTTTTTATTCTTGGGAGGCTTGGTATTCGTTGGTTGATGA

No Hit MAC Score Identity Cols Query HMM Template HMM

  Pairwise Query-Template Alignment